• May 21, 2021
chikwadrat

Profile ekspresji fragmentów pochodzących

Profile ekspresji fragmentów pochodzących z tRNA i ich potencjalne function w szpiczaku mnogim 

Background: A number of myeloma is an incurable hematologic malignancy. The invention of mechanisms could assist to seek out new therapeutic targets and delay survival. tRNA-related fragments (tRF) and tRNA halves (tiRNA) are small RNA derived from tRNAs and implicated in all kinds of pathological processes, together with most cancers initiation and development. Nonetheless, there are virtually no analysis reporting the function of those tRNA derived fragments in myeloma so far as we all know.

Strategies: On this research, we proposed the expression profiles of tRFs/tiRNAs in myeloma by means of RNA-sequencing in new recognized myeloma and wholesome donors. The expression of chosen tRFs/tiRNAs was additional validated in scientific specimens by qPCR. Bioinformatic evaluation was carried out to foretell their potential roles in a number of myeloma.

Outcomes: A complete of 33 upregulated tRFs/tiRNAs and 22 downregulated tRFs/tiRNAs have been recognized. GO enrichment and KEGG pathway evaluation have been carried out to research the features of 1 considerably up-regulated and one considerably down-regulated tRNA-derived fragments. tRFs/tiRNAs could also be concerned in MM initiation and development.

Conclusion: We concluded that tRFs/tiRNAs have been dysregulated and may very well be potential biomarkers for a number of myeloma.

chikwadrat
chikwadrat

Polyclonal Goat Anti-RAE1 Antibody

APG00265G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-RAE1 . This antibody is tested and proven to work in the following applications:

RAE1 antibody

22381-100ul 100ul
EUR 390

RAE1 antibody

70R-12978 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RAE1 antibody

RAE1 antibody

39124-100ul 100ul
EUR 252

RAE1 Antibody

DF8442 200ul
EUR 304
Description: RAE1 Antibody detects endogenous levels of total RAE1.

RAE1 antibody

70R-4675 50 ug
EUR 467
Description: Rabbit polyclonal RAE1 antibody

RAE1 antibody

70R-4676 50 ug
EUR 467
Description: Rabbit polyclonal RAE1 antibody

RAE1 Antibody

1-CSB-PA019276ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAE1. Recognizes RAE1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAE1 Antibody

ABD8442 100 ug
EUR 438

Rae1/ Rat Rae1 ELISA Kit

ELI-52491r 96 Tests
EUR 886

RAE1 Conjugated Antibody

C39124 100ul
EUR 397

RAE1 siRNA

20-abx904450
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAE1 siRNA

20-abx930796
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAE1 siRNA

20-abx930797
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal RAE1 Antibody (Center)

APR04909G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAE1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal RAE1 Antibody (Center)

APR06961G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAE1 (Center). This antibody is tested and proven to work in the following applications:

RAE1 Blocking Peptide

33R-2670 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAE1 antibody, catalog no. 70R-4675

RAE1 Blocking Peptide

33R-8290 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAE1 antibody, catalog no. 70R-4676

RAE1 Blocking Peptide

DF8442-BP 1mg
EUR 195

RAE1 cloning plasmid

CSB-CL019276HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1107
  • Sequence: ATGAGCCTGTTTGGAACAACCTCAGGTTTTGGAACCAGTGGGACCAGCATGTTTGGCAGTGCAACTACAGACAATCACAATCCCATGAAGGATATTGAAGTAACATCATCTCCTGATGATAGCATTGGTTGTCTGTCTTTTAGCCCACCAACCTTGCCGGGGAACTTTCTTATTG
  • Show more
Description: A cloning plasmid for the RAE1 gene.

RAE1 Rabbit pAb

A6713-100ul 100 ul
EUR 308

RAE1 Rabbit pAb

A6713-200ul 200 ul
EUR 459

RAE1 Rabbit pAb

A6713-20ul 20 ul
EUR 183

RAE1 Rabbit pAb

A6713-50ul 50 ul
EUR 223

Polyclonal RAE1 Antibody (N-Term)

APR04887G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAE1 (N-Term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

RAE1 ELISA KIT|Human

EF002293 96 Tests
EUR 689

Rat RAE1 shRNA Plasmid

20-abx990353
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RAE1 shRNA Plasmid

20-abx975736
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAE1 shRNA Plasmid

20-abx955559
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAE1 Recombinant Protein (Human)

RP042709 100 ug Ask for price

RAE1 Recombinant Protein (Mouse)

RP166550 100 ug Ask for price

RAE1 Recombinant Protein (Rat)

RP223505 100 ug Ask for price

Polyclonal RAE1 antibody - C-terminal region

APR00780G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAE1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal RAE1 antibody - C-terminal region

APR00781G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAE1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Ribonucleic Acid Export 1 (RAE1) Antibody

20-abx005150
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polyclonal MRNP41 / RAE1 Antibody (C-Terminus)

APG01100G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MRNP41 / RAE1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Ribonucleic Acid Export 1 (RAE1) Antibody

abx237086-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Ribonucleic Acid Export 1 (RAE1) Antibody

20-abx322391
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribonucleic Acid Export 1 (RAE1) Antibody

abx433213-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Human mRNA export factor (RAE1)

1-CSB-EP019276HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 68 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human mRNA export factor(RAE1) expressed in E.coli

Rae1 ORF Vector (Rat) (pORF)

ORF074503 1.0 ug DNA
EUR 506

RAE1 ORF Vector (Human) (pORF)

ORF014237 1.0 ug DNA
EUR 354

Rae1 ORF Vector (Mouse) (pORF)

ORF055518 1.0 ug DNA
EUR 506

Rae1 sgRNA CRISPR Lentivector set (Rat)

K7169401 3 x 1.0 ug
EUR 339

RAE1 sgRNA CRISPR Lentivector set (Human)

K1780301 3 x 1.0 ug
EUR 339

Rae1 sgRNA CRISPR Lentivector set (Mouse)

K3793301 3 x 1.0 ug
EUR 339

Rat mRNA export factor(RAE1) ELISA kit

E02M0433-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat mRNA export factor(RAE1) ELISA kit

E02M0433-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat mRNA export factor(RAE1) ELISA kit

E02M0433-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human mRNA export factor(RAE1) ELISA kit

E01M0433-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human mRNA export factor(RAE1) ELISA kit

E01M0433-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human mRNA export factor(RAE1) ELISA kit

E01M0433-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit mRNA export factor(RAE1) ELISA kit

E04M0433-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit mRNA export factor(RAE1) ELISA kit

E04M0433-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit mRNA export factor(RAE1) ELISA kit

E04M0433-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse mRNA export factor(RAE1) ELISA kit

E03M0433-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse mRNA export factor(RAE1) ELISA kit

E03M0433-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse mRNA export factor(RAE1) ELISA kit

E03M0433-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat mRNA export factor(RAE1) ELISA kit

E06M0433-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat mRNA export factor(RAE1) ELISA kit

E06M0433-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat mRNA export factor(RAE1) ELISA kit

E06M0433-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog mRNA export factor(RAE1) ELISA kit

E08M0433-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog mRNA export factor(RAE1) ELISA kit

E08M0433-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog mRNA export factor(RAE1) ELISA kit

E08M0433-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig mRNA export factor(RAE1) ELISA kit

E07M0433-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig mRNA export factor(RAE1) ELISA kit

E07M0433-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig mRNA export factor(RAE1) ELISA kit

E07M0433-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey mRNA export factor(RAE1) ELISA kit

E09M0433-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey mRNA export factor(RAE1) ELISA kit

E09M0433-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey mRNA export factor(RAE1) ELISA kit

E09M0433-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse mRNA export factor, Rae1 ELISA KIT

ELI-13997m 96 Tests
EUR 865

Porcine mRNA export factor, RAE1 ELISA KIT

ELI-19560p 96 Tests
EUR 928

Bovine mRNA export factor, RAE1 ELISA KIT

ELI-35553b 96 Tests
EUR 928

Human mRNA export factor, RAE1 ELISA KIT

ELI-36031h 96 Tests
EUR 824

Rae1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7169402 1.0 ug DNA
EUR 154

Rae1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7169403 1.0 ug DNA
EUR 154

Rae1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7169404 1.0 ug DNA
EUR 154

RAE1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1780302 1.0 ug DNA
EUR 154

RAE1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1780303 1.0 ug DNA
EUR 154

RAE1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1780304 1.0 ug DNA
EUR 154

Rae1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3793302 1.0 ug DNA
EUR 154

Rae1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3793303 1.0 ug DNA
EUR 154

Rae1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3793304 1.0 ug DNA
EUR 154

RAE1 Protein Vector (Rat) (pPB-C-His)

PV298010 500 ng
EUR 603

RAE1 Protein Vector (Rat) (pPB-N-His)

PV298011 500 ng
EUR 603

RAE1 Protein Vector (Rat) (pPM-C-HA)

PV298012 500 ng
EUR 603

RAE1 Protein Vector (Rat) (pPM-C-His)

PV298013 500 ng
EUR 603

RAE1 Protein Vector (Human) (pPB-C-His)

PV056945 500 ng
EUR 481

RAE1 Protein Vector (Human) (pPB-N-His)

PV056946 500 ng
EUR 481

RAE1 Protein Vector (Human) (pPM-C-HA)

PV056947 500 ng
EUR 481

RAE1 Protein Vector (Human) (pPM-C-His)

PV056948 500 ng
EUR 481

RAE1 Protein Vector (Mouse) (pPB-C-His)

PV222070 500 ng
EUR 603

Modulacja aktywności PKR przez mutacje fosfomimetyczne reszt seryny zlokalizowanych trzy aminokwasy powyżej motywów wiążących dwuniciowe RNA 

Eukaryotic translation initiation issue 2 alpha kinase 2 (EIF2AK2), higher often known as PKR, performs a key function within the response to viral infections and mobile homeostasis by regulating mRNA translation. Upon binding dsRNA, PKR is activated by means of homodimerization and subsequent autophosphorylation on residues Thr446 and Thr451. On this research, we recognized a novel PKR phosphorylation web site, Ser6, situated three amino acids upstream of the primary double-stranded RNA binding motif (DRBM1).

One other Ser residue happens in PKR at place 97, the exact same place relative to the DRBM2. Ser or Thr residues additionally happen three amino acids upstream DRBMs of different proteins akin to ADAR1 or DICER. Phosphoinhibiting mutations (Ser-to-Ala) launched at Ser6 and Ser97 spontaneously activated PKR. In distinction, phosphomimetic mutations (Ser-to-Asp) inhibited PKR activation following both poly (I:C) transfection or virus an infection. These mutations reasonably affected dsRNA binding or dimerization, suggesting a mannequin the place unfavorable expenses occurring at place 6 and 97 tighten the interplay of DRBMs with the kinase area, thus maintaining PKR in an inactive closed conformation even within the presence of dsRNA. This research supplies new insights on PKR regulation mechanisms and identifies Ser6 and Ser97 as potential targets to modulate PKR exercise for therapeutic functions.

Różnicowa proteomika korzeni sadzonek tytoniu przy wysokich i niskich stężeniach potasu 

The consequences of excessive potassium and regular potassium therapies on protein expression in roots of flue-cured tobacco plant HKDN-5 at the seedling stage have been analyzed by an unlabeled protein quantification approach. The outcomes confirmed that 555 proteins have been differentially expressed (245 proteins have been down-regulated and 310 proteins have been up-regulated) in excessive potassium remedy in contrast with regular potassium remedy. Differentially expressed proteins have been concerned in 96 metabolic pathways (42 metabolic pathways, 21 artificial pathways in addition to catabolic pathways, together with fatty acid metabolism, phenylpropane biosynthesis, ketone physique synthesis and degradation, and butyric acid metabolism.

Root processing of excessive potassium concentrations results in will increase within the synthesis of peroxidase, superoxide dismutase and acyl-coenzyme-A synthetase. Further proteomic variations noticed in tobacco roots grown in excessive potassium embrace proteins concerned with genetic info processing in addition to environmental sensing. Examples embrace RNA helicase, ABC transporters and enormous subunit GTPases. These up-regulated differentially expressed proteins perform primarily in protein translation, ribosome construction and protein synthesis. This means that underneath excessive potassium remedy, root protein artificial processes are accelerated and substance metabolism pathways are enhanced; thus, offering the fabric and energetic foundation for root progress.

Połączone badanie przesiewowe CRISPR identyfikuje m A jako pozytywny regulator aktywacji makrofagów 

m6RNA modification is implicated in a number of mobile responses. Nonetheless, its perform within the innate immune cells is poorly understood. Right here, we recognized main m6A “writers” as the highest candidate genes regulating macrophage activation by LPS in an RNA binding protein centered CRISPR screening. We have now confirmed that Mettl3-poor macrophages exhibited decreased TNF-α manufacturing upon LPS stimulation in vitro. Constantly, Mettl3 flox/flox;Lyzm-Cre mice displayed elevated susceptibility to bacterial an infection and confirmed sooner tumor progress.

Mechanistically, the transcripts of the Irakm gene encoding a unfavorable regulator of TLR4 signaling have been extremely adorned by m6A modification. METTL3 deficiency led to the lack of m6A modification on Irakm mRNA and slowed down its degradation, leading to a better stage of IRAKM, which in the end suppressed TLR signaling-mediated macrophage activation. Our findings display a beforehand unknown function for METTL3-mediated m6A modification in innate immune responses and implicate the m6A equipment as a possible most cancers immunotherapy goal.

Lityczne zakażenie mysim gammaherpeswirusem 68 aktywuje promotory gospodarza i wirusowej polimerazy RNA III i zwiększa niekodującą ekspresję RNA 

RNA polymerase III (pol III) transcribes a number of non-coding (nc) RNAs which are important for mobile perform. Pol III-dependent transcription can also be engaged throughout sure viral infections, together with the gammaherpesviruses (γHVs), the place pol III-dependent viral ncRNAs promote pathogenesis. Moreover, a number of host ncRNAs are upregulated throughout γHV an infection and play integral roles in pathogenesis by facilitating viral institution and gene expression. Right here, we sought to research how pol III promoters and transcripts are regulated throughout gammaherpesvirus an infection utilizing the murine gammaherpesvirus 68 (γHV68) system. To check the transcription of host and viral pol III-dependent ncRNAs, we analyzed a sequence of pol III promoters for host and viral ncRNAs utilizing a luciferase reporter optimized to measure pol III exercise. We measured promoter exercise from the reporter gene on the translation stage through luciferase exercise and on the transcription stage through RT-qPCR. We additional measured endogenous ncRNA expression at single cell-resolution by circulation cytometry.

These research demonstrated that lytic an infection with γHV68 elevated the transcription from a number of host and viral pol III promoters, and additional recognized the flexibility of accent sequences to affect each baseline and inducible promoter exercise after an infection. RNA circulation cytometry revealed the induction of endogenous pol III-derived ncRNAs that tightly correlated with viral gene expression. These research spotlight how lytic gammaherpesvirus an infection alters the transcriptional panorama of host cells to extend pol III-derived RNAs, a course of that will additional modify mobile perform and improve viral gene expression and pathogenesis.IMPORTANCEGammaherpesviruses are a first-rate instance of how viruses can alter the host transcriptional panorama to ascertain an infection. Regardless of main insights into how these viruses modify RNA polymerase II-dependent era of messenger RNAs, how these viruses affect the exercise of host RNA polymerase III stays a lot much less clear.

Small non-coding RNAs produced by RNA polymerase III are more and more acknowledged to play important regulatory roles in cell biology and virus an infection. Research of RNA polymerase III dependent transcription are sophisticated by a number of promoter varieties and various RNAs with variable stability and processing necessities. Right here, we characterised a reporter system to straight research RNA polymerase III-dependent responses throughout gammaherpesvirus an infection and utilized single-cell circulation cytometry-based strategies to disclose that gammaherpesvirus lytic replication broadly induces pol III exercise to boost host and viral non-coding RNA expression throughout the contaminated cell.

Leave a Reply

Your email address will not be published. Required fields are marked *